David W. Wright

Find an error

Name: Wright, David W.
Organization: Vanderbilt University , USA
Department: Department of Chemistry
Title: (PhD)

TOPICS

Co-reporter:Westley S. Bauer, Christopher P. Gulka, Lidalee Silva-Baucage, Nicholas M. Adams, Frederick R. Haselton, and David W. Wright
Analytical Chemistry October 3, 2017 Volume 89(Issue 19) pp:10216-10216
Publication Date(Web):August 30, 2017
DOI:10.1021/acs.analchem.7b01513
Multi-antigen rapid diagnostic tests (RDTs) are highly informative, simple, mobile, and inexpensive, making them valuable point-of-care (POC) diagnostic tools. However, these RDTs suffer from several technical limitations—the most significant being the failure to detect low levels of infection. To overcome this, we have developed a magnetic bead-based multiplex biomarker enrichment strategy that combines metal affinity and immunospecific capture to purify and enrich multiple target biomarkers. Modifying antibodies to contain histidine-rich peptides enables reversible loading onto immobilized metal affinity magnetic beads, generating a novel class of antibodies coined “Capture and Release” (CaR) antibody reagents. This approach extends the specificity of immunocapture to metal affinity magnetic beads while also maintaining a common trigger for releasing multiple biomarkers. Multiplex biomarker enrichment is accomplished by adding magnetic beads equipped with CaR antibody reagents to a large sample volume to capture biomarkers of interest. Once captured, these biomarkers are magnetically purified, concentrated, and released into a RDT-compatible volume. This system was tailored to enhance a popular dual-antigen lateral flow malaria RDT that targets Plasmodium falciparum histidine-rich protein-II (HRPII) and Plasmodium lactate dehydrogenase (pLDH). A suite of pLDH CaR antibody reagents were synthesized, characterized, and the optimal CaR antibody reagent was loaded onto magnetic beads to make a multiplex magnetic capture bead that simultaneously enriches pLDH and HRPII from Plasmodium falciparum parasitized blood samples. This system achieves a 17.5-fold improvement in the dual positive HRPII/pan-pLDH detection limits enabling visual detection of both antigens at levels correlating to 5 p/μL. This front-end sample processing system serves as an efficient strategy to improve the sensitivity of RDTs without the need for modifications or remanufacturing.
Co-reporter:Lauren E. Gibson;Christine F. Markwalter;Danielle W. Kimmel
Malaria Journal 2017 Volume 16( Issue 1) pp:350
Publication Date(Web):23 August 2017
DOI:10.1186/s12936-017-1996-4
Dried blood spots are commonly used for sample collection in clinical and non-clinical settings. This method is simple, and biomolecules in the samples remain stable for months at room temperature. In the field, blood samples for the study and diagnosis of malaria are often collected on dried blood spot cards, so development of a biomarker extraction and analysis method is needed.A simple extraction procedure for the malarial biomarker Plasmodium falciparum histidine-rich protein 2 (HRP2) from dried blood spots was optimized to achieve maximum extraction efficiency. This method was used to assess the stability of HRP2 in dried blood spots. Furthermore, 328 patient samples made available from rural Zambia were analysed for HRP2 using the developed method. These samples were collected at the initial administration of artemisinin-based combination therapy and at several points following treatment.An average extraction efficiency of 70% HRP2 with a low picomolar detection limit was achieved. In specific storage conditions HRP2 was found to be stable in dried blood spots for at least 6 months. Analysis of patient samples showed the method to have a sensitivity of 94% and a specificity of 89% when compared with microscopy, and trends in HRP2 clearance after treatment were observed.The dried blood spot ELISA for HRP2 was found to be sensitive, specific and accurate. The method was effectively used to assess biomarker clearance characteristics in patient samples, which prove it to be ideal for gaining further insight into the disease and epidemiological applications.
Co-reporter:C.F. Markwalter, I.K. Jang, R.A. Burton, G.J. Domingo, D.W. Wright
Analytical Biochemistry 2017 Volume 534(Volume 534) pp:
Publication Date(Web):1 October 2017
DOI:10.1016/j.ab.2017.07.010
•Kinetic parameters of 15 anti-HRP2 antibodies are measured by biolayer interferometry.•Kinetic constants are compared to a checkerboard ELISA of 225 antibody pairs.•Biolayer interferometry predicts antibody pair performance for HRP2 ELISA.•Capture mAbs with low koff and detection mAbs with high kon are best in HRP2 ELISA.Predicting antibody pair performance in a sandwich format streamlines development of antibody-based diagnostics and laboratory research tools, such as enzyme-linked immunosorbent assays (ELISAs) and lateral flow immunoassays (LFAs). We have evaluated panels of monoclonal antibodies against the malarial parasite biomarker Plasmodium falciparum histidine rich protein 2 (HRP2), including 9 new monoclonal antibodies, using biolayer interferometry (BLI) and screened antibody pairs in a checkerboard ELISA. This study showed BLI predicts antibody pair ELISA performance for HRP2. Pairs that included capture antibodies with low off-rate constants and detection antibodies with high on-rate constants performed best in an ELISA format.Download high-res image (362KB)Download full-size image
Co-reporter:Thomas F. Scherr;Sparsh Gupta;Frederick R. Haselton
Lab on a Chip (2001-Present) 2017 vol. 17(Issue 7) pp:1314-1322
Publication Date(Web):2017/03/29
DOI:10.1039/C6LC01580H
Many countries are shifting their efforts from malaria control to disease elimination. New technologies will be necessary to meet the more stringent demands of elimination campaigns, including improved quality control of malaria diagnostic tests, as well as an improved means for communicating test results among field healthcare workers, test manufacturers, and national ministries of health. In this report, we describe and evaluate an embedded barcode within standard rapid diagnostic tests as one potential solution. This information-augmented diagnostic test operates on the familiar principles of traditional lateral flow assays and simply replaces the control line with a control grid patterned in the shape of a QR (quick response) code. After the test is processed, the QR code appears on both positive or negative tests. In this report we demonstrate how this multipurpose code can be used not only to fulfill the control line role of test validation, but also to embed test manufacturing details, serve as a trigger for image capture, enable registration for image analysis, and correct for lighting effects. An accompanying mobile phone application automatically captures an image of the test when the QR code is recognized, decodes the QR code, performs image processing to determine the concentration of the malarial biomarker histidine-rich protein 2 at the test line, and transmits the test results and QR code payload to a secure web portal. This approach blends automated, sub-nanomolar biomarker detection, with near real-time reporting to provide quality assurance data that will help to achieve malaria elimination.
Co-reporter:Thomas F. Scherr;Sparsh Gupta;Frederick R. Haselton
Lab on a Chip (2001-Present) 2017 vol. 17(Issue 7) pp:1314-1322
Publication Date(Web):2017/03/29
DOI:10.1039/C6LC01580H
Many countries are shifting their efforts from malaria control to disease elimination. New technologies will be necessary to meet the more stringent demands of elimination campaigns, including improved quality control of malaria diagnostic tests, as well as an improved means for communicating test results among field healthcare workers, test manufacturers, and national ministries of health. In this report, we describe and evaluate an embedded barcode within standard rapid diagnostic tests as one potential solution. This information-augmented diagnostic test operates on the familiar principles of traditional lateral flow assays and simply replaces the control line with a control grid patterned in the shape of a QR (quick response) code. After the test is processed, the QR code appears on both positive or negative tests. In this report we demonstrate how this multipurpose code can be used not only to fulfill the control line role of test validation, but also to embed test manufacturing details, serve as a trigger for image capture, enable registration for image analysis, and correct for lighting effects. An accompanying mobile phone application automatically captures an image of the test when the QR code is recognized, decodes the QR code, performs image processing to determine the concentration of the malarial biomarker histidine-rich protein 2 at the test line, and transmits the test results and QR code payload to a secure web portal. This approach blends automated, sub-nanomolar biomarker detection, with near real-time reporting to provide quality assurance data that will help to achieve malaria elimination.
Co-reporter:Westley S. Bauer;Danielle W. Kimmel;Nicholas M. Adams;Lauren E. Gibson;Thomas F. Scherr;Kelly A. Richardson;Joseph A. Conrad;Hellen K. Matakala;Frederick R. Haselton
Analyst (1876-Present) 2017 vol. 142(Issue 9) pp:1569-1580
Publication Date(Web):2017/05/02
DOI:10.1039/C7AN00278E
Diagnosis of asymptomatic malaria poses a great challenge to global disease elimination efforts. Healthcare infrastructure in rural settings cannot support existing state-of-the-art tools necessary to diagnose asymptomatic malaria infections. Instead, lateral flow immunoassays (LFAs) are widely used as a diagnostic tool in malaria endemic areas. While LFAs are simple and easy to use, they are unable to detect low levels of parasite infection. We have developed a field deployable Magnetically-enabled Biomarker Extraction And Delivery System (mBEADS) that significantly improves limits of detection for several commercially available LFAs. Integration of mBEADS with leading commercial Plasmodium falciparum malaria LFAs improves detection limits to encompass an estimated 95% of the disease reservoir. This user-centered mBEADS platform makes significant improvements to a previously cumbersome malaria biomarker enrichment strategy by improving reagent stability, decreasing the processing time 10-fold, and reducing the assay cost 10-fold. The resulting mBEADS process adds just three minutes and less than $0.25 to the total cost of a single LFA, thus balancing sensitivity and practicality to align with the World Health Organization's ASSURED criteria for point-of-care (POC) testing.
Co-reporter:Christopher P. Gulka, Alexis C. Wong and David W. Wright  
Chemical Communications 2016 vol. 52(Issue 6) pp:1266-1269
Publication Date(Web):23 Nov 2015
DOI:10.1039/C5CC08211K
Upon reacting with tetrakis(hydroxymethyl) phosphonium chloride, 15 nm citrate gold nanoparticles rapidly assemble into linear chains, followed by slowly disassembling into monodisperse components. This work highlights the first example of 31P NMR on gold particles of this size and suggests that the phosphonium is oxidized on-particle, contributing to particle disassembly.
Co-reporter:Lauren E. Gibson and David W. Wright
Analytical Chemistry 2016 Volume 88(Issue 11) pp:5928
Publication Date(Web):May 9, 2016
DOI:10.1021/acs.analchem.6b00855
Disease diagnosis requires identification of biomarkers that occur in small quantities, making detection a difficult task. Effective diagnosis is an even greater challenge in low-resource areas of the world. Methods must be simple, stable, and sensitive so that tests can be easily administered and withstand uncontrolled environmental conditions. One approach to this issue is development of stable signal amplification strategies. In this work, we applied the nanocrystal-based signal amplification method to tetra(4-carboxyphenyl)porphyrin nanoparticles (TCPP NPs). The dissolution of the nanoparticle into thousands of porphyrin molecules results in amplified detection of the biomarker. By using nanoparticles as the signal-generating moiety, stability of the detection method is increased relative to commonly used enzyme-based assays. Additionally, the inherent fluorescent signal of TCPP molecules can be measured after nanoparticle dissolution. The ability to directly read the TCPP fluorescent signal increases assay simplicity by reducing the steps required for the test. This detection method was optimized by detecting rabbit IgG and then was applied to the detection of the malarial biomarker Plasmodium falciparum histidine-rich protein II (pfHRPII) from a complex matrix. The results for both biomarkers were assays with low picomolar limits of detection.
Co-reporter:Rebecca D. Sandlin, Kim Y. Fong, Renata Stiebler, Christopher P. Gulka, Jenny E. Nesbitt, Matheus P. Oliveira, Marcus F. Oliveira, and David W. Wright
Crystal Growth & Design 2016 Volume 16(Issue 5) pp:2542
Publication Date(Web):April 11, 2016
DOI:10.1021/acs.cgd.5b01580
Hemozoin is a unique biomineral that results from the sequestration of toxic free heme liberated as a consequence of hemoglobin degradation in the malaria parasite. Synthetic neutral lipid droplets (SNLDs) and phospholipids were previously shown to support the rapid formation of β-hematin, abiological hemozoin, under physiologically relevant pH and temperature, though the mechanism by which heme crystallization occurs remains unclear. Detergents are particularly interesting as a template because they are amphiphilic molecules that spontaneously organize into nanostructures and have been previously shown to mediate β-hematin formation. Here, 11 detergents were investigated to elucidate the physicochemical properties that best recapitulate crystal formation in the parasite. A strong correlation between the detergent’s molecular structure and the corresponding kinetics of β-hematin formation was observed, where higher molecular weight polar chains promoted faster reactions. The larger hydrophilic chains correlated to the detergent’s ability to rapidly sequester heme into the lipophilic core, allowing for crystal nucleation to occur. The data presented here suggest that detergent nanostructures promote β-hematin formation in a similar manner to SNLDs and phospholipids. Through understanding mediator properties that promote optimal crystal formation, we are able to establish an in vitro assay to probe this drug target pathway.
Co-reporter:Christine F. Markwalter, Keersten M. Davis, David W. Wright
Analytical Biochemistry 2016 Volume 493() pp:30-34
Publication Date(Web):15 January 2016
DOI:10.1016/j.ab.2015.10.003

Abstract

We report a sensitive, magnetic bead-based colorimetric assay for Plasmodium falciparum lactate dehydrogenase (PfLDH) in which the biomarker is extracted from parasitized whole blood and purified based on antigen binding to antibody-functionalized magnetic particles. Antigen-bound particles are washed, and PfLDH activity is measured on-bead using an optimized colorimetric enzyme reaction (limit of detection [LOD] = 21.1 ± 0.4 parasites/μl). Enhanced analytical sensitivity is achieved by removal of PfLDH from the sample matrix before detection and elimination of nonspecific reductases and species that interfere with the optimal detection wavelength for measuring assay development. The optimized assay represents a simple and effective diagnostic strategy for P. falciparum malaria with time-to-result of 45 min and detection limits similar to those of commercial enzyme-linked immunosorbent assay (ELISA) kits, which can take 4–6 h. This method could be expanded to detect all species of malaria by switching the capture antibody on the magnetic particles to a pan-specific Plasmodium LDH antibody.

Co-reporter:Christine F. Markwalter, Keersten M. Ricks, Anna L. Bitting, Lwiindi Mudenda, David W. Wright
Talanta 2016 Volume 161() pp:443-449
Publication Date(Web):1 December 2016
DOI:10.1016/j.talanta.2016.08.078
•Rapid, magnetic microparticle-based detection of pLDH and PfHRPII from one sample.•Detection of both biomarkers is critical in the context of malaria elimination.•Total incubation time of 35 min.•LODs an order of magnitude below commercial ELISA kits, within asymptomatic regime.•Reproducible across users over time, and simple enough for novice users.We have developed a rapid magnetic microparticle-based detection strategy for malarial biomarkers Plasmodium lactate dehydrogenase (pLDH) and Plasmodium falciparum histidine-rich protein II (PfHRPII). In this assay, magnetic particles functionalized with antibodies specific for pLDH and PfHRPII as well as detection antibodies with distinct enzymes for each biomarker are added to parasitized lysed blood samples. Sandwich complexes for pLDH and PfHRPII form on the surface of the magnetic beads, which are washed and sequentially re-suspended in detection enzyme substrate for each antigen. The developed simultaneous capture and sequential detection (SCSD) assay detects both biomarkers in samples as low as 2.0 parasites/µl, an order of magnitude below commercially available ELISA kits, has a total incubation time of 35 min, and was found to be reproducible between users over time. This assay provides a simple and efficient alternative to traditional 96-well plate ELISAs, which take 5–8 h to complete and are limited to one analyte. Further, the modularity of the magnetic bead-based SCSD ELISA format could serve as a platform for application to other diseases for which multi-biomarker detection is advantageous.Magnetic microparticle-based immunoassay reproducibly detects two malarial biomarkers in under an hour with detection limits an order of magnitude better than commercially available kits.Figure optionsDownload full-size imageDownload as PowerPoint slide
Co-reporter:Christopher P. Gulka, Joshua D. Swartz, David W. Wright
Talanta 2015 Volume 135() pp:94-101
Publication Date(Web):1 April 2015
DOI:10.1016/j.talanta.2014.12.047
•A low-resource assay for detection of a malaria biomarker, PfHRP-II, is presented.•A colorimetric signal is produced by rapid aggregation of Ni(II)NTA AuNPs.•The diagnostic platform stability is enhanced with a PEG4 spacer ligand.•The detection of biomarker occurs in a human serum albumin complex matrix.•No significant difference between smartphone and spectrophotometric processing.Diagnosing infectious diseases remains a challenge in the developing world where there is a lack of dependable electricity, running water, and skilled technicians. Although rapid immunochromatographic tests (RDTs) have been deployed to diagnose diseases such as malaria, the extreme climate conditions encountered in these regions compounded with the discrepancies in test manufacturing have yielded varying results, so that more innovative and robust technologies are sought. Devoid of antibodies and thermally sensitive materials, we present a robust, colorimetric diagnostic platform for the detection of a malarial biomarker, Plasmodium falciparum Histidine-Rich Protein 2 (PfHRP-II). The assay exploits the optical properties of gold nanoparticles, covalently coupling them to a Ni(II)NTA recognition element specific for PfHRP-II. In the presence of the recombinant malarial biomarker (rcHRP-II), the Ni(II)NTA AuNPs begin to crosslink and aggregate in as little as one minute, triggering a red-to-purple color change in solution. To increase assay sensitivity and platform stability suitable for low-resource regions, the Ni(II)NTA AuNPs were assembled with varying spacer ligands in a mixed monolayer presentation. When assembled with a negatively charged Peg4-thiol ligand, the Ni(II)NTA AuNPs demonstrate low nanomolar limits of rcHRP-II detection in physiological concentrations of human serum albumin and maintain excellent stability at 37°C when stored for four weeks. Detection of the malaria biomarker is also measured by capturing and processing images of aggregated gold nanoparticles with a smartphone camera. By utilizing a smartphone camera and image processing application, there is no significant difference in assay sensitivity and rcHRP-II limit of detection in comparison to a spectrophotometer, further making this diagnostic platform applicable for use in low-resource regions.
Co-reporter:Stephen R. Jackson ; James R. McBride ; Sandra J. Rosenthal
Journal of the American Chemical Society 2014 Volume 136(Issue 14) pp:5261-5263
Publication Date(Web):March 24, 2014
DOI:10.1021/ja501676y
The development of the seeded growth synthesis for gold nanorods provided the first simple, convenient wet chemistry route to these nanomaterials. Over the past decade, the original silver-assisted seeded growth procedure has been the subject of further modifications that have continuously expanded access to anisotropic gold nanoparticles; however, the role of silver in formation of gold nanorods remains poorly understood. We report the first experimental evidence on the position of silver present on gold nanorods using advanced energy dispersive X-ray spectroscopy. Our results indicate the deposition of silver ions on the surface shows no preference for a specific face or axis. Furthermore, we show that the “dog bone” structures developed from gold nanorod solutions show preferential deposition of silver atoms on the ends and in the crevices.
Co-reporter:Christopher P. Gulka, Joshua D. Swartz, Joshua R. Trantum, Keersten M. Davis, Corey M. Peak, Alexander J. Denton, Frederick R. Haselton, and David W. Wright
ACS Applied Materials & Interfaces 2014 Volume 6(Issue 9) pp:6257
Publication Date(Web):April 14, 2014
DOI:10.1021/am501452k
We report a novel, low-resource malaria diagnostic platform inspired by the coffee ring phenomenon, selective for Plasmodium falciparum histidine-rich protein-II (PfHRP-II), a biomarker indicative of the P. falciparum parasite strain. In this diagnostic design, a recombinant HRP-II (rcHRP-II) biomarker is sandwiched between 1 μm Ni(II)nitrilotriacetic acid (NTA) gold-plated polystyrene microspheres (AuPS) and Ni(II)NTA-functionalized glass. After rcHRP-II malaria biomarkers had reacted with Ni(II)NTA-functionalized particles, a 1 μL volume of the particle–protein conjugate solution is deposited onto a functionalized glass slide. Drop evaporation produces the radial flow characteristic of coffee ring formation, and particle–protein conjugates are transported toward the drop edge, where, in the presence of rcHRP-II, particles bind to the Ni(II)NTA-functionalized glass surface. After evaporation, a wash with deionized water removes nonspecifically bound materials while maintaining the integrity of the surface-coupled ring produced by the presence of the protein biomarker. The dynamic range of this design was found to span 3 orders of magnitude, and rings are visible with the naked eye at protein concentrations as low as 10 pM, 1 order of magnitude below the 100 pM PfHRP-II threshold recommended by the World Health Organization. Key enabling features of this design are the inert and robust gold nanoshell to reduce nonspecific interactions on the particle surface, inclusion of a water wash step after drop evaporation to reduce nonspecific binding to the glass, a large diameter particle to project a large two-dimensional viewable area after ring formation, and a low particle density to favor radial flow toward the drop edge and reduce vertical settling to the glass surface in the center of the drop. This robust, antibody-free assay offers a simple user interface and clinically relevant limits of biomarker detection, two critical features required for low-resource malaria detection.Keywords: histidine-rich proteins; low-resource diagnostics; malaria; Ni(II)NTA; polystyrene microspheres;
Co-reporter:K. M. Davis, L. E. Gibson, F. R. Haselton and D. W. Wright  
Analyst 2014 vol. 139(Issue 12) pp:3026-3031
Publication Date(Web):17 Apr 2014
DOI:10.1039/C4AN00338A
Lateral flow immunochromatographic rapid diagnostic tests (RDTs) are the primary form of medical diagnostic used for malaria in underdeveloped nations. Unfortunately, many of these tests do not detect asymptomatic malaria carriers. In order for eradication of the disease to be achieved, this problem must be solved. In this study, we demonstrate enhancement in the performance of six RDT brands when a simple sample-processing step is added to the front of the diagnostic process. Greater than a 4-fold RDT signal enhancement was observed as a result of the sample processing step. This lowered the limit of detection for RDT brands to submicroscopic parasitemias. For the best performing RDTs the limits of detection were found to be as low as 3 parasites per μL. Finally, through individual donor samples, the correlations between donor source, WHO panel detection scores and RDT signal intensities were explored.
Co-reporter:N. M. Adams, K. K. A. Wang, A. C. Caprioli, L. C. Thomas, B. Kankia, F. R. Haselton and D. W. Wright  
Analyst 2014 vol. 139(Issue 7) pp:1644-1652
Publication Date(Web):27 Jan 2014
DOI:10.1039/C3AN02261G
Simple and rapid methods for detecting mRNA biomarkers from patient samples are valuable in settings with limited access to laboratory resources. In this report, we describe the development and evaluation of a self-contained assay to extract and quantify mRNA biomarkers from complex samples using a novel nucleic acid-based molecular sensor called quadruplex priming amplification (QPA). QPA is a simple and robust isothermal nucleic acid amplification method that exploits the stability of the G-quadruplex nucleotide structure to drive spontaneous strand melting from a specific DNA template sequence. Quantification of mRNA was enabled by integrating QPA with a magnetic bead-based extraction method using an mRNA–QPA interface reagent. The assay was found to maintain >90% of the maximum signal over a 4 °C range of operational temperatures (64–68 °C). QPA had a dynamic range spanning four orders of magnitude, with a limit of detection of ∼20 pM template molecules using a highly controlled heating and optical system and a limit of detection of ∼250 pM using a less optimal water bath and plate reader. These results demonstrate that this integrated approach has potential as a simple and effective mRNA biomarker extraction and detection assay for use in limited resource settings.
Co-reporter:Keersten M. Davis, Anna L. Bitting, David W. Wright
Analytical Biochemistry 2014 Volume 445() pp:60-66
Publication Date(Web):15 January 2014
DOI:10.1016/j.ab.2013.10.007

Abstract

The need for robust reagents for biomarker detection has become an increasing necessity in designing point-of-care diagnostics. We report a non-emissive, cyclometalated iridium(III) complex, (Ir1), which, on coordination to a histidine-containing protein bound to the surface of a magnetic particle, elicits a rapid, long-lived phosphorescent signal. The interactions between Ir1 and numerous other amino acids were examined for activity, but only the addition of histidine resulted in a four orders of magnitude enhancement in signal intensity. Buffer conditions (pH and temperature) and composition (coordinating vs. non-coordinating and ionic strength) were optimized to achieve maximum signal and stability of Ir1. The activity of the probe under optimized conditions was validated with BNT-II, a histidine-containing branched peptide mimic of the malarial biomarker Plasmodium falciparum histidine-rich protein II (PfHRPII). By comparing Ir1 binding to BNT-II versus l-histidine, steric and quenching effects were noted in the peptide. Despite these deviations from ideal conditions, signal response reached saturation with both BNT-II and recombinant HRPII (rcHRPII). When immobilized on the surface of a 50 μM magnetic agarose particles, the limit of detection of rcHRPII was 14.5 nM. The robust signal response of this inorganic probe lends itself to future applications in on-particle enzyme-linked immunosorbent assay (ELISA)-based assays.

Co-reporter:Keersten M. Davis, Joshua D. Swartz, Frederick R. Haselton, and David W. Wright
Analytical Chemistry 2012 Volume 84(Issue 14) pp:6136
Publication Date(Web):June 13, 2012
DOI:10.1021/ac301030m
We have demonstrated the utility of a self-contained extraction device for the selective isolation, purification, and concentration of the malaria diagnostic protein biomarker Plasmodium falciparum histidine-rich protein II (pfHRPII) from human plasma and whole blood. The extraction cassette consists of a small-diameter tube containing a series of preloaded processing solutions separated by mineral oil valves. Nickel(II) nitrilotriacetic acid-functionalized magnetic particles are added to a parasite-spiked sample contained within the loading chamber of the device for capture of pfHRPII. The biomarker-bound magnetic particles are then entrained by an external magnetic field and transported through three wash solutions. Processing removes sample interfering agents, and the biomarker target is concentrated in the final chamber for subsequent analysis. At parasitemias of 200 parasites/μL, purification and concentration of pfHRPII with extraction efficiencies in excess of 70% total protein target are achieved. The concentration of nonspecific protein interfering agents was reduced by more than 2 orders of magnitude in the final extracted sample without the need for hours of processing time and specialized laboratory equipment. We have demonstrated an application of this low-resource technology by coupling extraction and concentration of pfHRPII within the cassette to a commonly employed rapid diagnostic test. Sample preprocessing improved the visual limit of detection of this test by over 8-fold, suggesting that the combination of both low-resource technologies could prove to be useful in malaria eradication efforts.
Co-reporter:Reese S. Harry, Leslie A. Hiatt, Danielle W. Kimmel, Clare K. Carney, Kristin C. Halfpenny, David E. Cliffel, and David W. Wright
Chemical Research in Toxicology 2012 Volume 25(Issue 8) pp:1643
Publication Date(Web):July 16, 2012
DOI:10.1021/tx3001048
Metabolic profiling of macrophage metabolic response upon exposure to 4-hydroxynonenal (HNE) demonstrates that HNE does not simply inactivate superoxide-generating enzymes but also could be responsible for the impairment of downfield signaling pathways. Multianalyte microphysiometry (MAMP) was employed to simultaneously measure perturbations in extracellular acidification, lactate production, and oxygen consumption for the examination of aerobic and anaerobic pathways. Combining the activation of oxidative burst with phorbol myristate acetate (PMA) and the immunosuppression with HNE, the complex nature of HNE toxicity was determined to be concentration- and time-dependent. Further analysis was utilized to assess the temporal effect of HNE on reactive oxygen species (ROS) production and on protein kinase C (PKC). Increased levels of HNE with decreasing PKC activity suggest that PKC is a target for HNE adductation prior to oxidative burst. Additionally, localization of PKC to the cell membrane was prevented with the introduction of HNE, demonstrating a consequence of HNE adductation on NADPH activation. The impairment of ROS by HNE suggests that HNE has a greater role in foam cell formation and tissue damage than is already known. Although work has been performed to understand the effect of HNE's regulation of specific signaling pathways, details regarding its involvement in cellular metabolism as a whole are generally unknown. This study examines the impact of HNE on macrophage oxidative burst and identifies PKC as a key protein for HNE suppression and eventual metabolic response.
Co-reporter:Nicholas M. Adams, Stephen R. Jackson, Frederick R. Haselton, and David W. Wright
Langmuir 2012 Volume 28(Issue 2) pp:1068-1082
Publication Date(Web):September 11, 2011
DOI:10.1021/la2028862
Nucleic-acid-functionalized gold surfaces have been used extensively for the development of biological sensors. The development of an effective biomarker detection assay requires careful design, synthesis, and characterization of probe components. In this Feature Article, we describe fundamental probe development constraints and provide a critical appraisal of the current methodologies and applications in the field. We discuss critical issues and obstacles that impede the sensitivity and reliability of the sensors to underscore the challenges that must be met to advance the field of biomarker detection.
Co-reporter:Jonas W. Perez, Elizabeth A. Vargis, Patricia K. Russ, Frederick R. Haselton, David W. Wright
Analytical Biochemistry 2011 Volume 410(Issue 1) pp:141-148
Publication Date(Web):1 March 2011
DOI:10.1016/j.ab.2010.11.033
In traditional immuno-polymerase chain reaction (immuno-PCR), a single antibody recognition event is associated with one to three DNA tags, which are subsequently amplified by PCR. Here we describe a nanoparticle-amplified immuno-PCR (NPA–IPCR) assay that combines antibody recognition of enzyme-linked immunosorbent assay (ELISA) with a 50-fold nanoparticle valence amplification step prior to tag amplification by PCR. The assay detects a respiratory syncytial virus (RSV) surface protein using an antibody bound to a 15-nm gold nanoparticle cofunctionalized with thiolated DNA complementary to a hybridized 76-base tag DNA with a tag DNA/antibody ratio of 50:1. The presence of virus particles triggers the formation of a “sandwich” complex composed of the gold nanoparticle construct, virus, and an antibody-functionalized magnetic particle used for extraction. After extraction, DNA tags are released by heating to 95 °C and detected via real-time PCR. The limit of detection of the assay was compared with ELISA and reversion transcription (RT) PCR using RSV-infected HEp-2 cell extracts. NPA–IPCR showed an approximately 4000-fold improvement in the limit of detection compared with ELISA and a 4-fold improvement compared with viral RNA extraction followed by traditional RT–PCR. NPA–IPCR offers a viable platform for the development of early-stage diagnostics requiring an exceptionally low limit of detection.
Co-reporter:Scott A. Miller;Leslie A. Hiatt;Robert G. Keil
Analytical and Bioanalytical Chemistry 2011 Volume 399( Issue 3) pp:1021-1029
Publication Date(Web):2011 January
DOI:10.1007/s00216-010-4419-8
Immunoassays are important tools for the rapid detection and identification of pathogens, both clinically and in the research laboratory. An immunoassay with the potential for the detection of influenza was developed and tested using hemagglutinin (HA), a commonly studied glycoprotein found on the surface of influenza virions. Gold nanoparticles were synthesized, which present multiple peptide epitopes, including the HA epitope, in order to increase the gravimetric response achieved with the use of a QCM immunosensor for influenza. Specifically, epitopes associated with HA and FLAG peptides were affixed to gold nanoparticles by a six-mer PEG spacer between the epitope and the terminal cysteine. The PEG spacer was shown to enhance the probability for interaction with antibodies by increasing the distance the epitope extends from the gold surface. These nanoparticles were characterized using thermogravimetric analysis, transmission electron microscopy, matrix-assisted laser desorption/ionization-time of flight, and 1H nuclear magnetic resonance analysis. Anti-FLAG and anti-HA antibodies were adhered to the surface of a QCM, and the response of each antibody upon exposure to HA, FLAG, and dual functionalized nanoparticles was compared with binding of Au–tiopronin nanoparticles and H5 HA proteins from influenza virus (H5N1). Results demonstrate that the immunoassay was capable of differentiating between nanoparticles presenting orthogonal epitopes in real-time with minimal nonspecific binding. The detection of H5 HA protein demonstrates the logical extension of using these nanoparticle mimics as a safe positive control in the detection of influenza, making this a vital step in improving influenza detection methodology.
Co-reporter:Joshua D. Swartz, Christopher P. Gulka, Frederick R. Haselton, and David W. Wright
Langmuir 2011 Volume 27(Issue 24) pp:15330-15339
Publication Date(Web):October 25, 2011
DOI:10.1021/la202937j
An antibody-free diagnostic reagent has been developed based on the aggregation-induced colorimetric change of Ni(II)NTA-functionalized colloidal gold and silver nanoparticles. This diagnostic strategy utilizes the high binding affinity of histidine-rich proteins with Ni(II)NTA to capture and cross-link the histidine-rich protein mimics with the silver and gold nanoparticles. In model studies, the aggregation behavior of the Ni(II)NTA nanoparticles was tested against synthetic targets including charged poly(amino acid)s (histidine, lysine, arginine, and aspartic acid) and mimics of Plasmodium falciparum histidine-rich protein 2 (pfHRP-II). Aggregation of the nanoparticle sensor was induced by all of the basic poly(amino acid)s including poly(l-histidine) within the pH range (5.5–9.0) tested, which is likely caused by the coordination between the multivalent polymer target and Ni(II)NTA groups on multiple particles. The peptide mimics induced aggregation of the nanoparticles only near their pKa’s with higher limits of detection. In addition, monomeric amino acids do not show any aggregation behavior, suggesting that multiple target binding sites are necessary for aggregation. Long-term stability studies showed that gold but not silver nanoparticles remained stable and exhibited similar aggregation behavior after 1 month of storage at room temperature and 37 °C. These results suggest that Ni(II)NTA gold nanoparticles could be further investigated for use as a sensor to detect histidine-rich proteins in biological samples.
Co-reporter:Ashwath Jayagopal ; Kristin C. Halfpenny ; Jonas W. Perez
Journal of the American Chemical Society 2010 Volume 132(Issue 28) pp:9789-9796
Publication Date(Web):June 29, 2010
DOI:10.1021/ja102585v
A strategy is presented for the live cell imaging of messenger RNA using hairpin DNA-functionalized gold nanoparticles (hAuNP). hAuNP improve upon technologies for studying RNA trafficking by their efficient internalization within live cells without transfection reagents, improved resistance to DNase degradation, low cytotoxicity, and the incorporation of hairpin DNA molecular beacons to confer high specificity and sensitivity to the target mRNA sequence. Furthermore, the targeted nanoparticle-beacon construct, once bound to the target mRNA sequence, remains hybridized to the target, enabling spatial and temporal studies of RNA trafficking and downstream analysis. Targeted hAuNP exhibited high specificity for glyceraldehyde 3-phosphate dehydrogenase (GADPH) mRNA in live normal HEp-2 cells and respiratory syncytial virus (RSV) mRNA in live RSV-infected HEp-2 cells with high target to background ratios. Multiplexed fluorescence imaging of distinct mRNAs in live cells and simultaneous imaging of mRNAs with immunofluorescently stained protein targets in fixed cells was enabled by appropriate selection of molecular beacon fluorophores. Pharmacologic analysis suggested that hAuNP were internalized within cells via membrane-nanoparticle interactions. hAuNP are a promising approach for the real-time analysis of mRNA transport and processing in live cells for elucidation of biological processes and disease pathogenesis.
Co-reporter:Joshua D. Swartz;Leila F. Deravi
Advanced Functional Materials 2010 Volume 20( Issue 9) pp:1488-1492
Publication Date(Web):
DOI:10.1002/adfm.200902169

Abstract

As a non-invasive, rapid prototyping technique, piezoelectric inkjet printing using the Dimatix Materials Printer (DMP) is incorporated to template 2D biologically active surfaces. In these studies, a bioinspired ink is synthesized and printed directly onto gold-coated silicon nitride substrates and into polymer-coated 96-well plates. Once deposited on a surface, these patterns are reacted with varying concentrations of a model enzyme glucose oxidase in the presence of a silica precursor, monosilicic acid. The reaction mechanism and order of reactant products within and along the patterns are shown to directly affect the integrity and overall microstructure of the biologically active films. Using profilometry measurements and scanning electron microscopy, a biologically active platform is optimized without significantly compromising the activity of the enzyme. In fact, enzyme activity, constrained within a thin film, is reported for the first time over variable reaction parameters. When compared to the enzyme free in solution, the immobilized enzyme is 25.9% active, where nearly 100% of the activity is retained after repeated usage.

Co-reporter:S. Reese Harry, Donna J. Hicks, Katayoun I. Amiri and David W. Wright  
Chemical Communications 2010 vol. 46(Issue 30) pp:5557-5559
Publication Date(Web):04 Jun 2010
DOI:10.1039/C001969K
A new intracellular mRNA imaging probe has been developed that incorporates thiol-terminated hairpin oligonucleotides covalently bound to the surface of citrate-capped gold nanoparticles. The hairpin DNA-coated gold nanoparticles (hAuNPs) positively identifies tyrosinase mRNA in cultured melanoma cells.
Co-reporter:Anh N. Hoang, Kanyile K. Ncokazi, Katherine A. de Villiers, David W. Wright and Timothy J. Egan  
Dalton Transactions 2010 vol. 39(Issue 5) pp:1235-1244
Publication Date(Web):20 Nov 2009
DOI:10.1039/B914359A
The mechanism of formation of haemozoin, a detoxification by-product of several blood-feeding organisms including malaria parasites, has been a subject of debate; however, recent studies suggest that neutral lipids may serve as a catalyst. In this study, a model system consisting of an emulsion of neutral lipid particles was employed to investigate the formation of β-haematin, the synthetic counterpart of haemozoin, at the lipid–water interface. A solution of monoglyceride, either monostearoylglycerol (MSG) or monopalmitoylglycerol (MPG), dissolved in acetone and methanol was introduced to an aqueous surface. Fluorescence, confocal and transmission electron microscopic (TEM) imaging and dynamic light scattering analysis of samples obtained from beneath the surface confirmed the presence of homogeneous lipid particles existing in two major populations: one in the low micrometre size range and the other in the hundred nanometre range. The introduction of haem (Fe(III)PPIX) to this lipid particle system under biomimetic conditions (37 °C, pH 4.8) produced β-haematin with apparent first-order kinetics and an average half life of 0.5 min. TEM of monoglycerides (MSG or MPG) extruded through a 200 nm filter with haem produced β-haematin crystals aligned and parallel to the lipid–water interface. These TEM data, together with a model system replacing the lipid with an aqueous organic solvent interface using either methyl laurate or docosane demonstrated that the OH and CO groups are apparently necessary for efficient nucleation. This suggests that β-haematin crystallizes via epitaxial nucleation at the lipid–water interface through interaction of Fe(III)PPIX with the polar head group. Once nucleated, the crystal grows parallel to the interface until growth is terminated by the curvature of the lipid particle. The hydrophobic nature of the mature crystal favours an interior transport resulting in crystals aligned parallel to the lipid–water interface and each other, strikingly similar to that seen in malaria parasites.
Co-reporter:Anh N. Hoang, Rebecca D. Sandlin, Aneesa Omar, Timothy J. Egan, and David W. Wright
Biochemistry 2010 Volume 49(Issue 47) pp:
Publication Date(Web):October 27, 2010
DOI:10.1021/bi101397u
In eukaryotic cells, neutral lipids serve as major energy storage molecules; however, in Plasmodium falciparum, a parasite responsible for causing malaria in humans, neutral lipids may have other functions during the intraerythrocytic stage of the parasite life cycle. Specifically, experimental data suggest that neutral lipid structures behave as a catalyst for the crystallization of hemozoin, a detoxification byproduct of several blood-feeding organisms, including malaria parasites. Synthetic neutral lipid droplets (SNLDs) were produced by depositing a lipid blend solution comprised of mono- and diglycerides onto an aqueous surface. These lipid droplets are able to mediate the production of brown pigments that are morphologically and chemically identical to hemozoin. The partitioning of heme into these SNLDs was examined by employing Nile Red, a lipid specific dye. Soluble ferriprotoporphyrin IX was observed to spontaneously localize to the lipid droplets, partitioning in a pH-dependent manner with an estimated log P of 2.6. Interestingly, the pH profile of heme partitioning closely resembles that of β-hematin formation. Differential scanning calorimetry and kinetic studies demonstrated that the SNLDs provide a unique environment that promotes hemozoin formation. SNLD-mediated formation of the malaria pigment displayed an activation energy barrier lower than those of individual lipid components. In particular, lipid droplets composed of diglycerides displayed activation barriers lower than those composed of monoglycerides. This difference was attributed to the greater fluidity of these lipids. In conjunction with the known pattern of lipid body proliferation, it is suggested that neutral lipid structures within the digestive vacuole not only are the location of in vivo hemozoin formation but are also essential for the survival of the parasite by functioning as a kinetically competent and site specific mediator for heme detoxification.
Co-reporter:Jonas W. Perez, Frederick R. Haselton and David W. Wright  
Analyst 2009 vol. 134(Issue 8) pp:1548-1553
Publication Date(Web):15 May 2009
DOI:10.1039/B904191E
Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify processing and enable fluorescence detection. The approach was evaluated by assaying for the presence of respiratory syncytial virus (RSV) using the DNA hairpin probe 5′ [C6Thiol]TTTTTTTTTTCGACGAAAAATGGGGCAAATACGTCG[CAL] 3′ covalently attached to a 5 cm length of a 100 µm diameter gold-clad filament. This sequence was designed to target a portion of the gene end-intergenic gene start signals which is repeated multiple times within the negative-sense genome giving multiple targets for each strand of genomic viral RNA present. The filament functionalized with probes was immersed in a 200 µm capillary tube containing viral RNA, moved to subsequent capillary tubes for rinsing and then scanned for fluorescence. The response curve had a typical sigmoidal shape and plateaued at about 300 plaque forming units (PFU) of viral RNA in 20 µL. The lower limit of detection was determined to be 11.9 PFU. This lower limit of detection was ∼200 times better than a standard comparison ELISA. The simplicity of the core assay makes this approach attractive for further development as a viral detection platform in a clinical setting.
Co-reporter:Joshua D. Swartz, Scott A. Miller and David Wright
Organic Process Research & Development 2009 Volume 13(Issue 3) pp:584-589
Publication Date(Web):April 8, 2009
DOI:10.1021/op9000065
Rapid and efficient immobilization of nitrilase within silica nanoparticles overcomes many hurdles associated with biocatalysis. A water-miscible dendrimer catalyzes the condensation of silicic acid to silica dioxide, entrapping electrostatically bound nitrilase molecules. Michaelis−Menten kinetics shows encapsulated nitrilase functions similarly to free nitrilase in solution. Additionally, HPLC analysis demonstrates that simple benchtop separation and recycling of the biocatalyst over 10 individual reactions are achieved without significant loss of enzyme and/or function. These findings broaden the use of nitrilases in the production of fine chemicals as well as general syntheses by overcoming some of the traditional barriers associated with enzyme reagents and nitrile conversion.
Co-reporter:Sarah L. Sewell, Ryan D. Rutledge and David W. Wright  
Dalton Transactions 2008 (Issue 29) pp:3857-3865
Publication Date(Web):13 Jun 2008
DOI:10.1039/B802842G
Biomimetic synthesis is emerging as an advantageous alternative to the harsh synthetic conditions traditionally used in metal oxide syntheses techniques. Silaffins, proteins from the C. fusiformis diatom, form silica in an aqueous environment under benign conditions. Amine terminated PAMAM and PPI dendrimers are effective mimics of silaffins and other silica precipitating polyamines. We have expanded the scope of dendrimer mediated metal oxide formation to include titanium dioxide, a photocatalyst, and germanium dioxide, a blue photoluminescent material. The nanoparticles were characterized using scanning electron microscopy (SEM), Fourier transform infrared spectroscopy (IR), and X-ray diffraction patterns (XRD). A variable temperature XRD analysis of TiO2 nanoparticles was conducted to study the transition from anatase to rutile. TiO2 nanoparticles synthesized in phosphate buffer showed a 200 °C decrease in the anatase to rutile transition temperature relative to TiO2 templated in water. XRD analysis of GeO2 nanoparticles in either water or phosphate buffer reveal crystalline α-phase germanium oxide. To our knowledge, this is the first report of the synthesis of crystalline GeO2 under ambient conditions.
Co-reporter:David Wright;Scott A. Miller;Edmund D. Hong
Macromolecular Bioscience 2006 Volume 6(Issue 10) pp:839-845
Publication Date(Web):13 OCT 2006
DOI:10.1002/mabi.200600140

Summary: We report the entrapment of horseradish peroxidase and quantitative encapsulation of glucose oxidase within silica nanoparticles by utilizing an amine-terminated dendritic template. Our improved strategy employs a water-soluble biomimetic template which is able to catalyze the condensation of Si(OH)4 to silica nanoparticles while trapping an enzyme inside the mesoporous material. Kinetic analysis shows enzyme functionality to be mostly unchanged. Also, the role of pI and ionic strength within the encapsulation environment was found to strongly influence encapsulation. These results suggest that the electrostatic manipulation of a strong supramolecular silica-precipitating complex of enzyme and dendrimer has the potential of adding a vast array of chemical and biological activity to hybrid materials.

Co-reporter:Edmund D. Hong;David Wright;Scott A. Miller
Macromolecular Bioscience 2006 Volume 6(Issue 10) pp:
Publication Date(Web):26 OCT 2006
DOI:10.1002/mabi.200690018
Co-reporter:Aren E. Gerdon, David W. Wright,David E. Cliffel
Angewandte Chemie International Edition 2006 45(4) pp:594-598
Publication Date(Web):
DOI:10.1002/anie.200503328
Co-reporter:Aren E. Gerdon Dr.;David E. Cliffel Dr.
Angewandte Chemie 2006 Volume 118(Issue 4) pp:
Publication Date(Web):15 DEC 2005
DOI:10.1002/ange.200503328

Keineswegs sekundär: Konformative und lineare Peptidepitope des Schutzantigens von B. anthracis wurden auf der Oberfläche von Monoschicht-geschützten Clustern präsentiert, um immunreaktive Nanostrukturen zu erhalten. Quarzkristallmikrowaagen-Studien an diesen Antigenmimetika mit Antikörpern legten einen deutlichen Unterschied nahe zwischen zwei Epitopen mit gleicher Primärstruktur, jedoch unterschiedlicher Sekundärstruktur.

Co-reporter:Joseph M. Slocik, Rajesh R. Naik, Morley O. Stone and David W. Wright  
Journal of Materials Chemistry A 2005 vol. 15(Issue 7) pp:749-753
Publication Date(Web):21 Dec 2004
DOI:10.1039/B413074J
Viruses present a confined environment and unique protein surface topology (i.e. polarity, residue charge, and surface relief) for nanoparticle synthesis and are amenable to molecular biology manipulations. Consequently, we have examined the cowpea chlorotic mottle viruses of unmodified SubE (yeast), (HRE)-SubE engineered with interior HRE peptide epitopes (AHHAHHAAD), and wild-type as viral templates for the potentiated reduction and symmetry directed synthesis of gold nanoparticles. In the first approach, the viral capsid actively potentiated the reduction of AuCl4− by electron transfer from surface tyrosine residues resulting in a gold nanoparticle decorated viral surface. Viral reduction appeared to be selective for gold as a collection of metal precursor substrates of Ag+, Pt4+, Pd4+, and an insoluble AuI complex were not reduced to zero-valent nanoclusters by virus. Alternatively, the viral capsid provided a template for the symmetry directed synthesis of Au0 nanoparticles from a non-reducible gold precursor.
Co-reporter:Marc R. Knecht and David W. Wright  
Chemical Communications 2003 (Issue 24) pp:3038-3039
Publication Date(Web):03 Nov 2003
DOI:10.1039/B309074D
A synthetic site-directed mutagenesis study of the non post-translationally modified silica precipitating R5 peptide reveals that the RRIL motif is critical in the formation of active silica precipitating assemblies.
Co-reporter:Kim Y. Fong, Rebecca D. Sandlin, David W. Wright
International Journal for Parasitology: Drugs and Drug Resistance (December 2015) Volume 5(Issue 3) pp:84-91
Publication Date(Web):1 December 2015
DOI:10.1016/j.ijpddr.2015.05.003
•Ten of 400 Malaria Box compounds were found to be potent β-hematin inhibitors.•We confirmed similar in vitro antimalarial activity to results from previous screens.•7 of the 9 commercially available hits were validated hemozoin inhibitors in culture.The Malaria Box, assembled by the Medicines for Malaria Venture, is a set of 400 structurally diverse, commercially available compounds with demonstrated activity against blood-stage Plasmodium falciparum. The compounds are a representative subset of the 20,000 in vitro antimalarials identified from the high-throughput screening efforts of St. Jude Children's Research Hospital (TN, USA), Novartis and GlaxoSmithKline. In addition, a small set of active compounds from commercially available libraries was added to this group, but it has not previously been published. Elucidation of the biochemical pathways on which these compounds act is a major challenge; therefore, access to these compounds has been made available free of charge to the investigator community. Here, the Malaria Box compounds were tested for activity against the formation of β-hematin, a synthetic form of the heme detoxification biomineral, hemozoin. Further, the mechanism of action of these compounds within the malaria parasite was explored. Ten of the Malaria Box compounds demonstrated significant inhibition of β-hematin formation. In this assay, dose–response data revealed IC50 values ranging from 8.7 to 22.7 μM for these hits, each of which is more potent than chloroquine (a known inhibitor of hemozoin formation). The in vitro antimalarial activity of these ten hits was confirmed in cultures of the chloroquine sensitive D6 strain of the parasite resulting in IC50 values of 135–2165 nM, followed by testing in the multidrug resistant strain, C235. Cultures of P. falciparum (D6) were then examined for their heme distribution following treatment with nine of the commercially available confirmed compounds, seven of which disrupted the hemozoin pathway.Download full-size image
Co-reporter:Rebecca D. Sandlin, Kim Y. Fong, Kathryn J. Wicht, Holly M. Carrell, ... David W. Wright
International Journal for Parasitology: Drugs and Drug Resistance (December 2014) Volume 4(Issue 3) pp:316-325
Publication Date(Web):1 December 2014
DOI:10.1016/j.ijpddr.2014.08.002
•Hemozoin formation is a prime drug target pathway to probe for new lead compounds.•We examined the VICB library of compounds for in vitro β-hematin inhibition.•β-Hematin inhibitors were tested for in vitro antimalarial activity in two P. falciparum strains.•Chemical scaffolds with target-specific and in vitro antimalarial activity were identified.The emergence of drug resistant strains of Plasmodium spp. creates a critical need for the development of novel antimalarials. Formation of hemozoin, a crystalline heme detoxification process vital to parasite survival serves as an important drug target. The quinoline antimalarials including chloroquine and amodiaquine owe their antimalarial activity to inhibition of hemozoin formation. Though in vivo formation of hemozoin occurs within the presence of neutral lipids, the lipophilic detergent NP-40 was previously shown to serve as a surrogate in the β-hematin (synthetic hemozoin) formation process. Consequently, an NP-40 mediated β-hematin formation assay was developed for use in high-throughput screening. Here, the assay was utilized to screen 144,330 compounds for the identification of inhibitors of crystallization, resulting in 530 hits. To establish the effectiveness of these target-based β-hematin inhibitors against Plasmodium falciparum, each hit was further tested in cultures of parasitized red blood cells. This effort revealed that 171 of the β-hematin inhibitors are also active against the parasite. Dose–response data identified 73 of these β-hematin inhibitors have IC50 values ⩽5 μM, including 25 compounds with nanomolar activity against P. falciparum. A scaffold-based analysis of this data identified 14 primary scaffolds that represent 46% of the 530 total hits. Representative compounds from each of the classes were further assessed for hemozoin inhibitory activity in P. falciparum infected human erythrocytes. Each of the hit compounds tested were found to be positive inhibitors, while a negative control did not perturb this biological pathway in culture.Download full-size image
Co-reporter:Anh N. Hoang, Kanyile K. Ncokazi, Katherine A. de Villiers, David W. Wright and Timothy J. Egan
Dalton Transactions 2010 - vol. 39(Issue 5) pp:NaN1244-1244
Publication Date(Web):2009/11/20
DOI:10.1039/B914359A
The mechanism of formation of haemozoin, a detoxification by-product of several blood-feeding organisms including malaria parasites, has been a subject of debate; however, recent studies suggest that neutral lipids may serve as a catalyst. In this study, a model system consisting of an emulsion of neutral lipid particles was employed to investigate the formation of β-haematin, the synthetic counterpart of haemozoin, at the lipid–water interface. A solution of monoglyceride, either monostearoylglycerol (MSG) or monopalmitoylglycerol (MPG), dissolved in acetone and methanol was introduced to an aqueous surface. Fluorescence, confocal and transmission electron microscopic (TEM) imaging and dynamic light scattering analysis of samples obtained from beneath the surface confirmed the presence of homogeneous lipid particles existing in two major populations: one in the low micrometre size range and the other in the hundred nanometre range. The introduction of haem (Fe(III)PPIX) to this lipid particle system under biomimetic conditions (37 °C, pH 4.8) produced β-haematin with apparent first-order kinetics and an average half life of 0.5 min. TEM of monoglycerides (MSG or MPG) extruded through a 200 nm filter with haem produced β-haematin crystals aligned and parallel to the lipid–water interface. These TEM data, together with a model system replacing the lipid with an aqueous organic solvent interface using either methyl laurate or docosane demonstrated that the OH and CO groups are apparently necessary for efficient nucleation. This suggests that β-haematin crystallizes via epitaxial nucleation at the lipid–water interface through interaction of Fe(III)PPIX with the polar head group. Once nucleated, the crystal grows parallel to the interface until growth is terminated by the curvature of the lipid particle. The hydrophobic nature of the mature crystal favours an interior transport resulting in crystals aligned parallel to the lipid–water interface and each other, strikingly similar to that seen in malaria parasites.
Co-reporter:S. Reese Harry, Donna J. Hicks, Katayoun I. Amiri and David W. Wright
Chemical Communications 2010 - vol. 46(Issue 30) pp:NaN5559-5559
Publication Date(Web):2010/06/04
DOI:10.1039/C001969K
A new intracellular mRNA imaging probe has been developed that incorporates thiol-terminated hairpin oligonucleotides covalently bound to the surface of citrate-capped gold nanoparticles. The hairpin DNA-coated gold nanoparticles (hAuNPs) positively identifies tyrosinase mRNA in cultured melanoma cells.
Co-reporter:Christopher P. Gulka, Alexis C. Wong and David W. Wright
Chemical Communications 2016 - vol. 52(Issue 6) pp:NaN1269-1269
Publication Date(Web):2015/11/23
DOI:10.1039/C5CC08211K
Upon reacting with tetrakis(hydroxymethyl) phosphonium chloride, 15 nm citrate gold nanoparticles rapidly assemble into linear chains, followed by slowly disassembling into monodisperse components. This work highlights the first example of 31P NMR on gold particles of this size and suggests that the phosphonium is oxidized on-particle, contributing to particle disassembly.
Co-reporter:Sarah L. Sewell, Ryan D. Rutledge and David W. Wright
Dalton Transactions 2008(Issue 29) pp:NaN3865-3865
Publication Date(Web):2008/06/13
DOI:10.1039/B802842G
Biomimetic synthesis is emerging as an advantageous alternative to the harsh synthetic conditions traditionally used in metal oxide syntheses techniques. Silaffins, proteins from the C. fusiformis diatom, form silica in an aqueous environment under benign conditions. Amine terminated PAMAM and PPI dendrimers are effective mimics of silaffins and other silica precipitating polyamines. We have expanded the scope of dendrimer mediated metal oxide formation to include titanium dioxide, a photocatalyst, and germanium dioxide, a blue photoluminescent material. The nanoparticles were characterized using scanning electron microscopy (SEM), Fourier transform infrared spectroscopy (IR), and X-ray diffraction patterns (XRD). A variable temperature XRD analysis of TiO2 nanoparticles was conducted to study the transition from anatase to rutile. TiO2 nanoparticles synthesized in phosphate buffer showed a 200 °C decrease in the anatase to rutile transition temperature relative to TiO2 templated in water. XRD analysis of GeO2 nanoparticles in either water or phosphate buffer reveal crystalline α-phase germanium oxide. To our knowledge, this is the first report of the synthesis of crystalline GeO2 under ambient conditions.
 
Mitogen-activated protein kinase p38
c-Jun N-terminal kinase
Gelatinase B
1,4-Naphthalenedione,2-[4-(4-chlorophenyl)cyclohexyl]-3-hydroxy-
TETRAKIS(HYDROXYMETHYL)PHOSPHANIUM;ACETATE;PHOSPHATE
2-[BIS(CARBOXYLATOMETHYL)AMINO]ACETATE;HYDRON;NICKEL(3+)